Journal: Cell communication and signaling : CCS

Article Title: Mitochondrial dysfunction and impaired DNA damage repair through PICT1 dysregulation in alveolar type II cells in emphysema.

doi: 10.1186/s12964-024-01896-0

Figure Lengend Snippet: Fig. 1 Decreased PICT1 protein expression in ATII cells in emphysema patients. Lung tissue and ATII cells were obtained from control non-smoker (N) and smoker (S) organ donors and emphysema patients (E). Panel I: A—PICT1 mRNA levels in lung tissue by RT-PCR. B—Representative Western blot images of PICT1 expression in lung tissue. C—Quantification of protein expression normalized to β-actin is shown. Panel II: A—PICT1 mRNA levels in ATII cells by RT-PCR. B—Representative Western blot images of PICT1 expression in ATII cells. C—Quantification of protein expression. Panel III: A – PICT1 was immunoprecipitated in lung tissue, followed by mass spectrometry analysis. Representative PICT1 (A) and TRIM22 spectrum (B) are shown. C TRIM22 mRNA expression in ATII cells by RT-PCR. D ATII cells were stained in lung tissue sections using SP-C (magenta), PICT1 (red), and TRIM22 (green) antibodies and DAPI (blue) followed by analysis by immunofluorescence (scale bar—5 μm). PICT1 fluorescence intensity in the nucleus (E) and cytoplasm (F) was quantified. G The ratio of nuclear to cytoplasmic PICT1 fluorescence intensity. H Pearson’s correlation coefficient for PICT1 and MRE11 fluorescence co-localization in ATII cells. Data are shown as means ± SEM (N = 3—14 lungs per group). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Article Snippet: PICT1 knockout A549 cell line was generated using PICT-1 CRISPR plasmid (Santa Cruz Biotechnology) and CRISPR-Cas9 technology, as we previously described [18].

Techniques: Expressing, Control, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunoprecipitation, Mass Spectrometry, Staining, Immunofluorescence, Fluorescence

Journal: Cell communication and signaling : CCS

Article Title: Mitochondrial dysfunction and impaired DNA damage repair through PICT1 dysregulation in alveolar type II cells in emphysema.

doi: 10.1186/s12964-024-01896-0

Figure Lengend Snippet: Fig. 3 Decreased MRE11 protein levels in ATII cells in a murine model of emphysema. Wild-type mice were exposed to cigarette smoke for 8 months, as described in the Methods section, to induce emphysema. A Hematoxylin and eosin staining in murine lung tissue (scale bar 50 μm). Minimum (B), maximum (C), and mean (D) alveolar diameters were measured in lung tissue sections. E Representative micro-CT of the murine lung (scale bar-100 μm). F The intersection surface was quantified using micro-CT images. G Pict1 and H Mre11 mRNA levels were evaluated in lung tissue by RT-PCR. I Representative Western blotting images of PICT1 and MRE11 expression in lung tissue. PICT1 (J) and MRE11 expression (K) are quantified. L ATII cells in lung tissue sections were identified using SP-C (green). PICT1 (magenta), and MRE11 (red) antibodies, and DAPI (blue) by immunofluorescence (scale bar—5 μm). Quantification of PICT1 (M) and MRE11 (N) fluorescence intensity in ATII cells is shown. O Pearson’s correlation coefficient for PICT1 and MRE11 fluorescence co-localization. Data are shown as means ± SEM (N = 3 – 8 mice per group). p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Article Snippet: PICT1 knockout A549 cell line was generated using PICT-1 CRISPR plasmid (Santa Cruz Biotechnology) and CRISPR-Cas9 technology, as we previously described [18].

Techniques: Staining, Micro-CT, Reverse Transcription Polymerase Chain Reaction, Western Blot, Expressing, Immunofluorescence, Fluorescence

Journal: Cell communication and signaling : CCS

Article Title: Mitochondrial dysfunction and impaired DNA damage repair through PICT1 dysregulation in alveolar type II cells in emphysema.

doi: 10.1186/s12964-024-01896-0

Figure Lengend Snippet: Fig. 6 Mitochondrial dysfunction in human primary ATII cells, A549 cells, and MLE15 cells. A PICT1 (red), TOM20 (green), and DAPI (blue) staining in lung tissue sections obtained from non-smokers (N), smokers (S), and emphysema patients (E) by immunofluorescence (scale bar—5 μm). ATII cells were identified using SP-C (magenta). B Pearson’s correlation coefficient for PICT1 and TOM20 co-localization in ATII cells is shown (N = 3 lungs per group). C Quantification of mitochondrial networks in ATII cells. D Mitochondrial respiration analysis in wild-type A549 cells and cells with PICT1 deletion treated with 20% cigarette smoke extract (CSE) for 24 h. Quantification of basal respiration (E) and maximum respiration (F) in A549 cells. G ATP-linked respiration after exposure to CSE relative to controls in A549 cells. QPCR was used to determine mtDNA amount (H), mtDNA damage (I), and common deletions (CD, J) in A549 cells. Representative histograms using MitoSOX staining and flow cytometry analysis (K) and the quantification of fluorescence intensity (L) in A549 cells. M Representative Western blotting images of MLE15 cells treated with NT (non-target) or PICT1 siRNA. N Histograms of MitoSOX staining by flow cytometry analysis (N) and quantification (O) in MLE15 cells. Data are shown as means ± SEM (KD – knockdown, N = 3 – 10 experimental replicates). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Article Snippet: PICT1 knockout A549 cell line was generated using PICT-1 CRISPR plasmid (Santa Cruz Biotechnology) and CRISPR-Cas9 technology, as we previously described [18].

Techniques: Staining, Immunofluorescence, Flow Cytometry, Fluorescence, Western Blot, Knockdown

Journal: Cell communication and signaling : CCS

Article Title: Mitochondrial dysfunction and impaired DNA damage repair through PICT1 dysregulation in alveolar type II cells in emphysema.

doi: 10.1186/s12964-024-01896-0

Figure Lengend Snippet: Fig. 7 The role of PICT1 in nuclear DNA damage and mitochondrial (mt) function. Increased PICT1/TRIM22 interaction induced by smoking leads to decreased PICT1 levels and high ROS production. This caused nuclear and mtDNA damage, common deletions, mitochondrial superoxide generation, and reduced mtDNA amount and respiration, contributing to ATII cell death and emphysema development

Article Snippet: PICT1 knockout A549 cell line was generated using PICT-1 CRISPR plasmid (Santa Cruz Biotechnology) and CRISPR-Cas9 technology, as we previously described [18].

Techniques:

Journal: Cell reports

Article Title: SCP4-STK35/PDIK1L complex is a dual phospho-catalytic signaling dependency in acute myeloid leukemia

doi: 10.1016/j.celrep.2021.110233

Figure Lengend Snippet: (A) Competition-based proliferation assays in 23 human cancer cell lines infected with the indicated sgRNAs. PDAC, pancreatic ductal adenocarcinoma; RMS, rhabdomyosarcoma. n = 3. (B) Western blot of whole-cell lysates from MOLM-13 cells on day 5 post-infection with the indicated sgRNAs. (C) Competition-based proliferation assay in MOLM-13 cells infected with the indicated sgRNAs. n = 3. (D) Western blot of whole-cell lysates from K562 cells on day 5 post-infection with the indicated sgRNAs. (E) Competition-based proliferation assay in K562 cells infected with the indicated sgRNAs. n = 3. (F) Quantification of the different cell-cycle stages in MOLM-13 cells on day 5 post-infection with the indicated sgRNAs. n = 3. (G) Bioluminescence imaging of NSG mice transplanted with luciferase + /Cas9 + MOLM-13 cells infected with either sgROSA or sgSCP4. (H) Quantification of bioluminescence intensity. n = 3. p value was calculated by unpaired Student’s t-test. *p < 0.05. (I) Western blot of whole-cell lysates from CD34 + cells electroporated with Cas9 loaded with the indicated sgRNAs on day 8 post-electroporation, with culturing in myeloid conditions. (J) qRT-PCR analysis of indels presence in CD34 + cells electroporated with Cas9 loaded with the indicated sgRNAs over the course of culturing in myeloid conditions. The effects of individual sgRNAs for SCP4 were averaged. n = 4. (K) Quantification of the flow cytometry analysis of myeloid differentiation of CD34 + cells electroporated with Cas9 loaded with the indicated sgRNAs on day 8 post-electroporation, with culturing in myeloid conditions. The effects of individual negative controls and sgRNAs for SCP4 were averaged. n = 4. All bar graphs represent the mean ± SEM. All sgRNA experiments were performed in Cas9-expressing cell lines. “e” refers to the exon number targeted by each sgRNA. The indicated sgRNAs were linked to GFP. ROSA, Mock, and NT, negative controls; PCNA and MYC, positive controls. See also .

Article Snippet: Antibodies used in this study included SCP4 ( CTDSPL2 ) (CST, # 6932, 1:500), FLAG (Sigma Aldrich, F1804, 1:10,000), HA-HRP (Sigma Aldrich, clone 3F10, 1:10,000), H3K4me3 (Sigma Aldrich, 07–473, 1:1,000), β-Actin-HRP (Sigma A3854-200UL; 1:50,000).

Techniques: Infection, Western Blot, Proliferation Assay, Imaging, Luciferase, Electroporation, Quantitative RT-PCR, Flow Cytometry, Expressing

Journal: Cell reports

Article Title: SCP4-STK35/PDIK1L complex is a dual phospho-catalytic signaling dependency in acute myeloid leukemia

doi: 10.1016/j.celrep.2021.110233

Figure Lengend Snippet: (A) Relative evolutionary conservation score for each residue from 0 — least conserved to 1 — most conserved. Based on data from . (B) Protein disorder prediction score for each residue from 0 — least disordered to 1 — most disordered. Based on data from . (C) Running average of log 2 fold changes of the CRISPR scan of SCP4 with all the possible sgRNAs. SCP4 protein amino acid numbers are indicated along the x axis. (D) Domain architectures of human SCP4 and the truncated version of SCP4 used in this study. (E) Western blot of whole-cell lysates from MOLM-13 cells stably expressing empty vector or CRISPR-resistant SCP4 236–466 . (F) Competition-based proliferation assay in MOLM-13 cells stably expressing empty vector or CRISPR-resistant SCP4 236–466 infected with the indicated sgRNAs. n = 3. (G) Western blot of whole-cell lysates from MOLM-13 cells stably expressing empty vector (EV; underloaded) or CRISPR-resistant wild type (WT) and catalytic mutants of SCP4. Vertical black dashed lines indicate omitted lanes from the same gel and same exposure. (H) Competition-based proliferation assay in MOLM-13 cells stably expressing empty vector or CRISPR-resistant WT and catalytic mutants of SCP4 infected with the indicated sgRNAs. n = 3. All bar graphs represent the mean ± SEM. ROSA, negative control; PCNA, positive control. See also and .

Article Snippet: Antibodies used in this study included SCP4 ( CTDSPL2 ) (CST, # 6932, 1:500), FLAG (Sigma Aldrich, F1804, 1:10,000), HA-HRP (Sigma Aldrich, clone 3F10, 1:10,000), H3K4me3 (Sigma Aldrich, 07–473, 1:1,000), β-Actin-HRP (Sigma A3854-200UL; 1:50,000).

Techniques: Residue, CRISPR, Western Blot, Stable Transfection, Expressing, Plasmid Preparation, Proliferation Assay, Infection, Negative Control, Positive Control

Journal: Cell reports

Article Title: SCP4-STK35/PDIK1L complex is a dual phospho-catalytic signaling dependency in acute myeloid leukemia

doi: 10.1016/j.celrep.2021.110233

Figure Lengend Snippet: (A) Western blot of cytoplasm and nuclear fractions from MOLM-13 cells. (B) Representative FLAG-SCP4 affinity purification western blot analysis for the subsequent mass spectrometry (MS) analysis. Cytoplasm and nucleus fractions from MOLM-13 cells stably expressing empty vector, FLAG-SCP4 WT, or catalytic mutant (D293A). Nuclear fraction was mixed with anti-FLAG M2 agarose overnight. The flow-through was analyzed to ensure efficient binding of the FLAG-tagged constructs (loaded as “unbound”). Following extensive washing, the agarose amount equivalent to the cytoplasm and nucleus fractions loading was boiled in Laemmli buffer and loaded as “FLAG-IP.” The rest was sent for the MS analysis. (C) Venn diagram depicting the overlap between proteins detected by MS and absent in empty vector controls in the 2 independent biological replicates. (D) Total unique peptide counts for SCP4, PDIK1L, and STK35 detected by MS in the 2 independent biological replicates. (E) Domain architectures and homology heat-map of human STK35 and PDIK1L. ATP-BS, ATP-binding site. (F–H) Immunoprecipitation followed by western blotting performed with the indicated antibodies. The whole-cell lysate was prepared from HEK293T 24 h post-transfection with the indicated constructs (F). The nuclear lysates were prepared from the human MOLM-13 cells stably expressing the indicated constructs (G and H). –, empty vector; WT, wild-type FLAG-SCP4; 236–466, FLAG-SCP4 236–466 ; D293A, catalytic mutant FLAG-SCP4 D293A ; IP, immunoprecipitation. Note: degradation bands appear in the WT and D293A input at ~50 kDa and in D293A at ~40 kDa. See also .

Article Snippet: Antibodies used in this study included SCP4 ( CTDSPL2 ) (CST, # 6932, 1:500), FLAG (Sigma Aldrich, F1804, 1:10,000), HA-HRP (Sigma Aldrich, clone 3F10, 1:10,000), H3K4me3 (Sigma Aldrich, 07–473, 1:1,000), β-Actin-HRP (Sigma A3854-200UL; 1:50,000).

Techniques: Western Blot, Affinity Purification, Mass Spectrometry, Stable Transfection, Expressing, Plasmid Preparation, Mutagenesis, Binding Assay, Construct, Immunoprecipitation, Transfection

Journal: Cell reports

Article Title: SCP4-STK35/PDIK1L complex is a dual phospho-catalytic signaling dependency in acute myeloid leukemia

doi: 10.1016/j.celrep.2021.110233

Figure Lengend Snippet: (A and B) Western blot of cytoplasm (Cyto) and nucleus (Nucl) fractions of MOLM-13 cells stably expressing HA-PDIK1L (A) or HA-STK35 (B) on day 5 post-infection with the indicated sgRNAs. Shown is a representative experiment of 3 independent biological replicates. (C) Schematics of phosphorylation sites reported in the publicly available phospho-proteomics datasets on STK35 and PDK1L relative to their domain architectures ( ; ). aa #, amino acid number; P, phosphorylation; ATP-BS, ATP-binding site. (D) Phosphorylated peptides assayed for SCP4 phosphatase activity in vitro . (E) Recombinant SCP4 protein purity as assessed by SDS-PAGE and Coomassie blue staining. His-SUMO-(TEV)-SCP4 was expressed in BL21 (DE3) cells and purified by affinity, anion exchange, and gel filtration chromatography. Molecular weight markers are shown for reference. (F and G) Phosphatase activity of SCP4 against the indicated peptides plotted for kinetic fitting. Each measurement was conducted in triplicate with standard deviations shown as error bars. (H) Competition-based proliferation assay in MOLM-13 cells stably expressing EV or the CR HA-PDIK1L or HA-STK35 constructs harboring the indicated amino acid substitutions infected with the indicated sgRNAs. n = 3. (I) Western blot of whole-cell lysates from MOLM-13 cells stably expressing EV or CR HA-PDIK1L or HA-STK35 constructs harboring the indicated amino acid substitutions. All bar graphs represent the mean ± SEM. See also .

Article Snippet: Antibodies used in this study included SCP4 ( CTDSPL2 ) (CST, # 6932, 1:500), FLAG (Sigma Aldrich, F1804, 1:10,000), HA-HRP (Sigma Aldrich, clone 3F10, 1:10,000), H3K4me3 (Sigma Aldrich, 07–473, 1:1,000), β-Actin-HRP (Sigma A3854-200UL; 1:50,000).

Techniques: Western Blot, Stable Transfection, Expressing, Infection, Phospho-proteomics, Binding Assay, Activity Assay, In Vitro, Recombinant, SDS Page, Staining, Purification, Filtration, Chromatography, Molecular Weight, Proliferation Assay, Construct

Journal: Cell reports

Article Title: SCP4-STK35/PDIK1L complex is a dual phospho-catalytic signaling dependency in acute myeloid leukemia

doi: 10.1016/j.celrep.2021.110233

Figure Lengend Snippet: (A) Venn diagram depicting the overlap between statistically significant downregulated genes in MOLM-13 cells upon SCP4 knockout and STK35/PDIK1L double knockout. DeSeq2 (n = 4). (B) Ontology analysis of overlapping statistically significant downregulated genes in MOLM-13 cells upon both SCP4 knockout and STK35/PDIK1L double knockout. (C) Selected statistically significant downregulated genes in MOLM-13 cells upon both SCP4 knockout and STK35/PDIK1L double knockout and the amino acids they are involved in biosynthesis or transport of. (D) The correlation between log2 fold changes in the levels of selected metabolites upon SCP4 knockout and STK35/PDIK1L double knockout relative to negative control as measured by the MS analysis. Every dot represents the mean ± SEM (n = 6). Amino acids are in red, and there are a few unchanged metabolites in black for reference. Shown is a representative experiment of 3 independent biological replicates. (E) Model. See also .

Article Snippet: Antibodies used in this study included SCP4 ( CTDSPL2 ) (CST, # 6932, 1:500), FLAG (Sigma Aldrich, F1804, 1:10,000), HA-HRP (Sigma Aldrich, clone 3F10, 1:10,000), H3K4me3 (Sigma Aldrich, 07–473, 1:1,000), β-Actin-HRP (Sigma A3854-200UL; 1:50,000).

Techniques: Knock-Out, Double Knockout, Negative Control

Journal: Cell reports

Article Title: SCP4-STK35/PDIK1L complex is a dual phospho-catalytic signaling dependency in acute myeloid leukemia

doi: 10.1016/j.celrep.2021.110233

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Antibodies used in this study included SCP4 ( CTDSPL2 ) (CST, # 6932, 1:500), FLAG (Sigma Aldrich, F1804, 1:10,000), HA-HRP (Sigma Aldrich, clone 3F10, 1:10,000), H3K4me3 (Sigma Aldrich, 07–473, 1:1,000), β-Actin-HRP (Sigma A3854-200UL; 1:50,000).

Techniques: Virus, Recombinant, Lysis, Plasmid Preparation, Magnetic Beads, Cloning, Purification, Bicinchoninic Acid Protein Assay, SYBR Green Assay, Gel Extraction, Ligation, Sample Prep, Mass Spectrometry, Software

Journal: Journal of biological rhythms

Article Title: The Paralogous Krüppel-like Factors 9 and 13 Regulate the Mammalian Cellular Circadian Clock Output Gene Dbp

doi: 10.1177/0748730420913205

Figure Lengend Snippet: Circadian rhythmicity in Dbp mRna was abolished in Klf9 and Klf13 double knockout ht22 cells. We created single and double knockout cells using CRisPR/Cas9 genome editing. We plated cells at equal densities, treated with 1 μM CORt for 1 h at 6-h intervals through 60 h to synchronize circadian gene expression, and then all cells were harvested together at 66 h for analysis of Dbp mRna by real-time quantitative polymerase chain reaction. We analyzed circadian rhythmicity using CircWave software. the ht22 parent cell line (wild type) showed statistically significant circadian oscillation in Dbp mRna. Mutation of Klf9 or Klf13 alone did not affect the Dbp mRna rhythm. By contrast, regular oscillations in Dbp mRna were abolished in the double knockout cells. each point represents the mean ± seM (n = 4/treatment).

Article Snippet: To construct the pcDNA4:TO- Klf13 expression vector, we used pCMV-Entry- Klf13 (MR224297; OriGene, Rockville, MD) as template to PCR amplify the Klf13 open reading frame, then we directionally subcloned this DNA fragment into the pCDNA4:TO vector (Invitrogen, Carlsbad, CA; in the absence of the tet repressor, this is a constitutive expression vector).

Techniques: Double Knockout, CRISPR, Expressing, Real-time Polymerase Chain Reaction, Software, Mutagenesis

Journal: Journal of biological rhythms

Article Title: The Paralogous Krüppel-like Factors 9 and 13 Regulate the Mammalian Cellular Circadian Clock Output Gene Dbp

doi: 10.1177/0748730420913205

Figure Lengend Snippet: Circadian clock and clock-output genes are genomic targets of KLF13 in ht22 cells and in mouse hippocampus; KLF13 may regulate multiple components of the cellular circadian clock. (a) Genome browser tracks (University of California, santa Cruz) showing the location of KLF13 peaks at clock and clock-output genes identified by chromatin-streptavidin precipitation followed by deep sequencing in ht22 cells. Black boxes below the tracks indicate exons, with the direction of transcription 5′→3′, left to right. Gray boxes indicate locations of CLOCK ChiP-seq peaks identified in mouse liver by Yoshitane and colleagues (2014). (B) KLF13 associates in chromatin from mouse hippocampus at Dbp, Tef, and Wee1 genes, analyzed by chromatin immunoprecipitation assay. asterisks indicate statistically significant differences between antiserum to KLF13 and normal immunoglobulin G analyzed by unpaired student’s t test (p < 0.05). (C) Forced expression of Klf13 represses baseline and CLOCK+BMaL1-dependent activation of the full-length Dbp reporter. We co-transfected heK293 cells with the psFV-Dbp-luc reporter vector with or without varying amounts of the pcDna4:tO-Klf13 expression vector and with or without pshuttle-Clock plus pshuttle-Bmal1. We analyzed reporter activity by dual luciferase assay. Bars represent the mean ± seM (n = 4 wells/treatment; –Clock+Bmal1: F3,12 = 6.371, p = 0.008; +Clock+Bmal1: F3,12 = 136.637, p < 0.0001; analysis of variance; the experiment was repeated twice with similar results). Means with the same letter are not significantly different (p < 0.05, Fisher’s least significant difference post hoc test). Co-transfection of Clock and Bmal1 expression vectors activated transcription by the reporter in the absence of pcDna4:tO-Klf13 (0 dose control; p < 0.0001, unpaired student’s t test).

Article Snippet: To construct the pcDNA4:TO- Klf13 expression vector, we used pCMV-Entry- Klf13 (MR224297; OriGene, Rockville, MD) as template to PCR amplify the Klf13 open reading frame, then we directionally subcloned this DNA fragment into the pCDNA4:TO vector (Invitrogen, Carlsbad, CA; in the absence of the tet repressor, this is a constitutive expression vector).

Techniques: Sequencing, ChIP-sequencing, Chromatin Immunoprecipitation, Expressing, Activation Assay, Transfection, Plasmid Preparation, Activity Assay, Luciferase, Cotransfection

Journal: eLife

Article Title: P2Y1 purinergic receptor identified as a diabetes target in a small-molecule screen to reverse circadian β-cell failure

doi: 10.7554/eLife.75132

Figure Lengend Snippet: ( A ) Venn diagram of BMAL1 binding sites identified by ChIP-sequencing overlapping with differentially expressed genes identified by RNA-sequencing in Bmal1 -/- β-cell line compared to control cell line (top). Browser tracks and bar graph showing decreased expression of P2ry1 gene in Bmal1 -/- cells compared to controls. BMAL1 binding sites upstream of the P2ry1 gene are also indicated (bottom). ( B ) Bioluminescence from WT insulin-NanoLuciferase pseudoislets in response to 10 µM IVM and/or 10 µM of the P2Y1 antagonist MRS2179 (n = 3–8 experiments, 3–15 experimental repeats/experiment). ( C ) Ratiometric determination of intracellular Ca 2+ using Fura2-AM dye in WT Beta-TC-6 cells stimulated in the presence or absence of 10 µM IVM (n = 3–7 experiments, 4–19 experimental repeats/experiment). ( D ) Insulin secretion by ELISA in pseudoislets from P2ry1 KOs and control WT and Bmal1 -/- Beta-TC-6 cells (n = 4 experiments, two experimental repeats/experiment). p-Values were determined by Tukey’s multiple comparison tests following two-way ANOVA. ( E ) First two principal components (PC1 and PC2) following unbiased principal component analysis (PCA) of DESeq2 normalized counts in WT, WT + IVM, P2yr1 KO, and P2yr1 KO cells (n = 4 per group). ( F ) Mean log 2 -transformed DESeq2-normalized counts in WT, WT + IVM, P2yr1 KO, and P2yr1 KO cells (n = 4 per group) at differentially expressed (1.5-fold, adjusted p-value<0.05) transcripts identified between WT and WT + IVM treated cells. All values represent mean ± SEM. *p<0.05, **p<0.01, ***p<0.001.

Article Snippet: Recombinant DNA reagent , P2Y1 CRISPR/Cas9 KO plasmid , Santa Cruz Biotechnology , sc-422095 , Pool of three plasmids, encoding the Cas9 nuclease and a P2Y1-specific 20 nt guide RNA, targeting exon 1 of the mouse P2ry1 gene.

Techniques: Binding Assay, ChIP-sequencing, RNA Sequencing, Control, Expressing, Enzyme-linked Immunosorbent Assay, Comparison, Transformation Assay

Journal: eLife

Article Title: P2Y1 purinergic receptor identified as a diabetes target in a small-molecule screen to reverse circadian β-cell failure

doi: 10.7554/eLife.75132

Figure Lengend Snippet: ( A ) mRNA abundance (transcripts per million [TPM]) in WT β-cells (left), DESeq2-adjusted p-values from differential expression analysis in Bmal1 -/- versus WT β-cells (middle left), fold change in expression in Bmal1 -/- versus WT β-cells (middle right), and presence or absence of an annotated BMAL1 binding site near genes of putative ivermectin (IVM) targets (right). ( B ) Rhythmic expression of P2ry1 gene in synchronized pseudoislets from WT Beta-TC-6 cells as assessed by quantitative real-time PCR (n = 3) (false discovery rate (FDR)-adjusted p-value<0.05). ( C ) Uniform manifold approximation and projection (UMAP) clustering analysis of single-cell expression values in single human islet cells isolated from type 2 diabetic and healthy subjects highlights distinct transcriptional profiles of β, α, δ, and γ cells marked by high levels of insulin ( INS ), glucagon ( GCG ), somatostatin ( SST ), or pancreatic polypeptide ( PPY ) mRNA, respectively. P2RY1 expression is enriched in β and δ cells, and grossly excluded from α and γ cells.

Article Snippet: Recombinant DNA reagent , P2Y1 CRISPR/Cas9 KO plasmid , Santa Cruz Biotechnology , sc-422095 , Pool of three plasmids, encoding the Cas9 nuclease and a P2Y1-specific 20 nt guide RNA, targeting exon 1 of the mouse P2ry1 gene.

Techniques: Quantitative Proteomics, Expressing, Binding Assay, Real-time Polymerase Chain Reaction, Isolation

Journal: eLife

Article Title: P2Y1 purinergic receptor identified as a diabetes target in a small-molecule screen to reverse circadian β-cell failure

doi: 10.7554/eLife.75132

Figure Lengend Snippet: ( A ) Quantitative real-time PCR screening for disruption of P2ry1 gene expression (n = 3–4/genotype) (top). Decreased P2Y1 receptor protein expression by Western blot in WT and Bmal1 -/- Beta-TC-6 cells after genetic disruption (bottom). ( B ) Loss of effect of IVM on gene expression in P2ry1 mutant β-cells identified by RNA-sequencing (n = 4/genotype/condition). Dots represent values that exceed 1.5-fold of the interquartile range. All values represent mean ± SEM. *p<0.05, **p<0.01, ***p<0.001. See and . Figure 4—figure supplement 2—source data 1. P2Y1 expression by Western blot. Figure 4—figure supplement 2—source data 2. ACTIN expression by Western blot.

Article Snippet: Recombinant DNA reagent , P2Y1 CRISPR/Cas9 KO plasmid , Santa Cruz Biotechnology , sc-422095 , Pool of three plasmids, encoding the Cas9 nuclease and a P2Y1-specific 20 nt guide RNA, targeting exon 1 of the mouse P2ry1 gene.

Techniques: Real-time Polymerase Chain Reaction, Disruption, Gene Expression, Expressing, Western Blot, Mutagenesis, RNA Sequencing

Journal: eLife

Article Title: P2Y1 purinergic receptor identified as a diabetes target in a small-molecule screen to reverse circadian β-cell failure

doi: 10.7554/eLife.75132

Figure Lengend Snippet:

Article Snippet: Recombinant DNA reagent , P2Y1 CRISPR/Cas9 KO plasmid , Santa Cruz Biotechnology , sc-422095 , Pool of three plasmids, encoding the Cas9 nuclease and a P2Y1-specific 20 nt guide RNA, targeting exon 1 of the mouse P2ry1 gene.

Techniques: Mutagenesis, Double Knockout, Isolation, Expressing, Recombinant, CRISPR, Plasmid Preparation, Drug discovery, Luciferase, Enzyme-linked Immunosorbent Assay, Reverse Transcription, SYBR Green Assay, Bradford Protein Assay, Sequencing, Software, Modification, Protease Inhibitor

Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of the loss-of-function metastasis screen using the mouse genome-scale CRISPR/Cas9 knock-out library (mGeCKOa).

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: CRISPR, Knock-Out

Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of lentiviral transduction of Cas9-GFP KPD cells with single sgRNAs designed to target one gene or miR. After puromycin selection, the cell population was transplanted into Nu/Nu mice and also deep sequenced to examine the distribution of indels at the target site. After 5 weeks, the primary tumor and lungs are examined.

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: Transduction, Selection

Journal: Cell reports

Article Title: MCK2-mediated MCMV infection of macrophages and virus dissemination to the salivary gland depends on MHC class I molecules.

doi: 10.1016/j.celrep.2023.112597

Figure Lengend Snippet: Figure 2. Neuropilin 1 (Nrp1) and CX3CR1 do not mediate MCK2-dependent MCMV infection of macrophages (A) Representative flow cytometry histograms plots of Nrp1 levels on NIH/3T3 fibroblasts or RAW 264.7 monocyte/macrophage cells without nucleofection or nucleofected with CRISPR-Cas9 ribonucleoparticles targeting Nrp1 (Nrp1 RNPs). (B) Quantification of mCherry signal at 20 hpi with indicated MCMV strains at MOI of 1 from cells treated with control (Ctrl.) RNPs or Nrp1 RNPs. (C) Representative flow cytometry histograms plots of CX3CR1 levels on NIH/3T3 fibroblasts or RAW 264.7 monocyte/macrophage cells that were nucleofected with Ctrl. or CX3CR1 RNPs. (D) Quantification of mCherry signal at 20 hpi with MCMV-3DR at MOI of 1 from cells treated with Ctrl. RNPs or CX3CR1 RNPs. (E) Quantification of mCherry signal at 20 hpi with MCMV-3D or -3DR at MOI of 1 from alveolar macrophages collected by bronchoalveolar lavage from wild-type (WT) or Cx3cr1/ mice. (B and D) Data are from 3–4 independent experiments. One dot equals a mean of the triplicates from one experiment, line at mean value per group. (E) Data are from 2 experiments with 5–6 animals per group (dots), and line represents mean value per group. (C–E) Statistical analysis: one-way ANOVA test followed by Sidak’s multiple comparison test; ns, not significant; **p < 0.01, ***p < 0.001, ****p < 0.0001.

Article Snippet: Next, SpCas9-expressing Nrp1 / NIH/3T3 fibroblasts were then transduced with the Mouse Brie CRISPR knockout lentiviral prep (Addgene #73633-LV) as described previously.48,49 Next, two biological replicates of cells expressing mouse Brie library were infected with MCK2+ MCMV-3DR at MOI 10.

Techniques: Infection, Cytometry, CRISPR, Control, Comparison

Journal: Cell reports

Article Title: Upregulation of exosome secretion from tumor-associated macrophages plays a key role in the suppression of anti-tumor immunity.

doi: 10.1016/j.celrep.2023.113224

Figure Lengend Snippet: Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Article Snippet: Murine TNF-a: 50-GGTGCCTATGTCTCAGCCTCTT-30 and 50-GCCATAGAA CTGA TGAGAGGGAG-3’; Murine IL-1b: 50- TGGACCTTCCAGGATGAGGACA-3’; Murine IL-6: 50-T ACCACTTCACAAGTCG GAGGC-30 and 50- CTGCAAGTGCATCA TCGTTG TTC-3’; TGF-b: 50-TGATACGCCTGAGTGGCTGTCT-3’; GAPDH: 50-CATCACT GCCACC CAGAAGACTG-30 and 50-ATGCCAGTGAGCTTCCCGTTCAG-3’. shRNA knockdown and CRISPR-Cas9 knockout shRNAs against human RAB27A (NM_004850, GCTGCCAATGGGACAAACATA, CAGGAGAGGTTTCGTAGCTA),96 mouse RAB27A (NM_001301230.1, CGAAACTGGATAA GCCAGCTA, GACAAACATAAGCCACGCGAT), human MADD (NG_029462.1, CCACAAGT ACAAGACGCCAAT, CCTGAAAGTATTTGGGCTAAA), mouse MADD (NM_001177720.1, CCACAAGTACAAGACGCCAAT, CCGCTCATTTATGGCAATGAT) or scrambled shRNA (Addgene, Catalog Number:1864) were co-transfected with viral packaging plasmids to package lentiviral particles using HEK293T cells.

Techniques: Expressing, Clinical Proteomics