Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of the loss-of-function metastasis screen using the mouse genome-scale CRISPR/Cas9 knock-out library (mGeCKOa).

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: CRISPR, Knock-Out

Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of lentiviral transduction of Cas9-GFP KPD cells with single sgRNAs designed to target one gene or miR. After puromycin selection, the cell population was transplanted into Nu/Nu mice and also deep sequenced to examine the distribution of indels at the target site. After 5 weeks, the primary tumor and lungs are examined.

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: Transduction, Selection

Journal: Cell reports

Article Title: MCK2-mediated MCMV infection of macrophages and virus dissemination to the salivary gland depends on MHC class I molecules.

doi: 10.1016/j.celrep.2023.112597

Figure Lengend Snippet: Figure 2. Neuropilin 1 (Nrp1) and CX3CR1 do not mediate MCK2-dependent MCMV infection of macrophages (A) Representative flow cytometry histograms plots of Nrp1 levels on NIH/3T3 fibroblasts or RAW 264.7 monocyte/macrophage cells without nucleofection or nucleofected with CRISPR-Cas9 ribonucleoparticles targeting Nrp1 (Nrp1 RNPs). (B) Quantification of mCherry signal at 20 hpi with indicated MCMV strains at MOI of 1 from cells treated with control (Ctrl.) RNPs or Nrp1 RNPs. (C) Representative flow cytometry histograms plots of CX3CR1 levels on NIH/3T3 fibroblasts or RAW 264.7 monocyte/macrophage cells that were nucleofected with Ctrl. or CX3CR1 RNPs. (D) Quantification of mCherry signal at 20 hpi with MCMV-3DR at MOI of 1 from cells treated with Ctrl. RNPs or CX3CR1 RNPs. (E) Quantification of mCherry signal at 20 hpi with MCMV-3D or -3DR at MOI of 1 from alveolar macrophages collected by bronchoalveolar lavage from wild-type (WT) or Cx3cr1/ mice. (B and D) Data are from 3–4 independent experiments. One dot equals a mean of the triplicates from one experiment, line at mean value per group. (E) Data are from 2 experiments with 5–6 animals per group (dots), and line represents mean value per group. (C–E) Statistical analysis: one-way ANOVA test followed by Sidak’s multiple comparison test; ns, not significant; **p < 0.01, ***p < 0.001, ****p < 0.0001.

Article Snippet: Next, SpCas9-expressing Nrp1 / NIH/3T3 fibroblasts were then transduced with the Mouse Brie CRISPR knockout lentiviral prep (Addgene #73633-LV) as described previously.48,49 Next, two biological replicates of cells expressing mouse Brie library were infected with MCK2+ MCMV-3DR at MOI 10.

Techniques: Infection, Cytometry, CRISPR, Control, Comparison

Journal: Cell reports

Article Title: Upregulation of exosome secretion from tumor-associated macrophages plays a key role in the suppression of anti-tumor immunity.

doi: 10.1016/j.celrep.2023.113224

Figure Lengend Snippet: Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Article Snippet: Murine TNF-a: 50-GGTGCCTATGTCTCAGCCTCTT-30 and 50-GCCATAGAA CTGA TGAGAGGGAG-3’; Murine IL-1b: 50- TGGACCTTCCAGGATGAGGACA-3’; Murine IL-6: 50-T ACCACTTCACAAGTCG GAGGC-30 and 50- CTGCAAGTGCATCA TCGTTG TTC-3’; TGF-b: 50-TGATACGCCTGAGTGGCTGTCT-3’; GAPDH: 50-CATCACT GCCACC CAGAAGACTG-30 and 50-ATGCCAGTGAGCTTCCCGTTCAG-3’. shRNA knockdown and CRISPR-Cas9 knockout shRNAs against human RAB27A (NM_004850, GCTGCCAATGGGACAAACATA, CAGGAGAGGTTTCGTAGCTA),96 mouse RAB27A (NM_001301230.1, CGAAACTGGATAA GCCAGCTA, GACAAACATAAGCCACGCGAT), human MADD (NG_029462.1, CCACAAGT ACAAGACGCCAAT, CCTGAAAGTATTTGGGCTAAA), mouse MADD (NM_001177720.1, CCACAAGTACAAGACGCCAAT, CCGCTCATTTATGGCAATGAT) or scrambled shRNA (Addgene, Catalog Number:1864) were co-transfected with viral packaging plasmids to package lentiviral particles using HEK293T cells.

Techniques: Expressing, Clinical Proteomics

Journal: bioRxiv

Article Title: Catalytic-independent functions of INTAC in conferring sensitivity to BET inhibition

doi: 10.1101/2024.02.07.579305

Figure Lengend Snippet: (A) Flow chart of the genome-wide CRISPR screening conducted to enrich cells with acquired resistance to BET inhibition in Eμ-Myc cells with the stable expression of Cas9. (B) Rank plot showing the log2 fold change (JQ1 versus DMSO) of sgRNA reads in survived cells post JQ1 treatment. Top ten enriched sgRNA targets and genes encoding INTAC complex labeled in color. (C) Schematic of the INTAC complex, components of the auxiliary module are highlighted. (D) Western blotting for INTS10, INTS13, INTS14 and INTS15 in CRISPR knockout Eμ-Myc cells. β-actin is a loading control. (E) Cell survival assays in sgCtr, sgINTS10, sgINTS13, sgINTS14 and sgINTS15 Eμ-Myc cells treated with DMSO or JQ1. (F) Western blotting for INTS1, INTS8 and INTS11 in CRISPR knockout Eμ-Myc cells. (G) Cell survival assays in sgCtr, sgINTS1, sgINTS8 and sgINTS11 Eμ-Myc cells treated with DMSO or JQ1. (H) Measurement for transcription termination of the representative snRNAs Rnu1a1 and Rnu3b2 in sgCtr, sgINTS15, sgINTS10, sgINTS8 and sgINTS11 Eμ-Myc cells. (I) Western blotting for RNA Pol II phosphorylation levels at carboxyl-terminal domain (CTD) Serine 5 (pSer5) and Serine 2 (pSer2) in sgCtr, sgINTS15, sgINTS10, sgINTS8 and sgINTS11 Eμ-Myc cells. β-actin is a loading control. See also Figure S1.

Article Snippet: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli.

Techniques: Genome Wide, CRISPR, Inhibition, Expressing, Labeling, Western Blot, Knock-Out, Control, Phospho-proteomics

Journal: Cell communication and signaling : CCS

Article Title: Mitochondrial dysfunction and impaired DNA damage repair through PICT1 dysregulation in alveolar type II cells in emphysema.

doi: 10.1186/s12964-024-01896-0

Figure Lengend Snippet: Fig. 1 Decreased PICT1 protein expression in ATII cells in emphysema patients. Lung tissue and ATII cells were obtained from control non-smoker (N) and smoker (S) organ donors and emphysema patients (E). Panel I: A—PICT1 mRNA levels in lung tissue by RT-PCR. B—Representative Western blot images of PICT1 expression in lung tissue. C—Quantification of protein expression normalized to β-actin is shown. Panel II: A—PICT1 mRNA levels in ATII cells by RT-PCR. B—Representative Western blot images of PICT1 expression in ATII cells. C—Quantification of protein expression. Panel III: A – PICT1 was immunoprecipitated in lung tissue, followed by mass spectrometry analysis. Representative PICT1 (A) and TRIM22 spectrum (B) are shown. C TRIM22 mRNA expression in ATII cells by RT-PCR. D ATII cells were stained in lung tissue sections using SP-C (magenta), PICT1 (red), and TRIM22 (green) antibodies and DAPI (blue) followed by analysis by immunofluorescence (scale bar—5 μm). PICT1 fluorescence intensity in the nucleus (E) and cytoplasm (F) was quantified. G The ratio of nuclear to cytoplasmic PICT1 fluorescence intensity. H Pearson’s correlation coefficient for PICT1 and MRE11 fluorescence co-localization in ATII cells. Data are shown as means ± SEM (N = 3—14 lungs per group). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Article Snippet: PICT1 knockout A549 cell line was generated using PICT-1 CRISPR plasmid (Santa Cruz Biotechnology) and CRISPR-Cas9 technology, as we previously described [18].

Techniques: Expressing, Control, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunoprecipitation, Mass Spectrometry, Staining, Immunofluorescence, Fluorescence

Journal: Cell communication and signaling : CCS

Article Title: Mitochondrial dysfunction and impaired DNA damage repair through PICT1 dysregulation in alveolar type II cells in emphysema.

doi: 10.1186/s12964-024-01896-0

Figure Lengend Snippet: Fig. 3 Decreased MRE11 protein levels in ATII cells in a murine model of emphysema. Wild-type mice were exposed to cigarette smoke for 8 months, as described in the Methods section, to induce emphysema. A Hematoxylin and eosin staining in murine lung tissue (scale bar 50 μm). Minimum (B), maximum (C), and mean (D) alveolar diameters were measured in lung tissue sections. E Representative micro-CT of the murine lung (scale bar-100 μm). F The intersection surface was quantified using micro-CT images. G Pict1 and H Mre11 mRNA levels were evaluated in lung tissue by RT-PCR. I Representative Western blotting images of PICT1 and MRE11 expression in lung tissue. PICT1 (J) and MRE11 expression (K) are quantified. L ATII cells in lung tissue sections were identified using SP-C (green). PICT1 (magenta), and MRE11 (red) antibodies, and DAPI (blue) by immunofluorescence (scale bar—5 μm). Quantification of PICT1 (M) and MRE11 (N) fluorescence intensity in ATII cells is shown. O Pearson’s correlation coefficient for PICT1 and MRE11 fluorescence co-localization. Data are shown as means ± SEM (N = 3 – 8 mice per group). p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Article Snippet: PICT1 knockout A549 cell line was generated using PICT-1 CRISPR plasmid (Santa Cruz Biotechnology) and CRISPR-Cas9 technology, as we previously described [18].

Techniques: Staining, Micro-CT, Reverse Transcription Polymerase Chain Reaction, Western Blot, Expressing, Immunofluorescence, Fluorescence

Journal: Cell communication and signaling : CCS

Article Title: Mitochondrial dysfunction and impaired DNA damage repair through PICT1 dysregulation in alveolar type II cells in emphysema.

doi: 10.1186/s12964-024-01896-0

Figure Lengend Snippet: Fig. 6 Mitochondrial dysfunction in human primary ATII cells, A549 cells, and MLE15 cells. A PICT1 (red), TOM20 (green), and DAPI (blue) staining in lung tissue sections obtained from non-smokers (N), smokers (S), and emphysema patients (E) by immunofluorescence (scale bar—5 μm). ATII cells were identified using SP-C (magenta). B Pearson’s correlation coefficient for PICT1 and TOM20 co-localization in ATII cells is shown (N = 3 lungs per group). C Quantification of mitochondrial networks in ATII cells. D Mitochondrial respiration analysis in wild-type A549 cells and cells with PICT1 deletion treated with 20% cigarette smoke extract (CSE) for 24 h. Quantification of basal respiration (E) and maximum respiration (F) in A549 cells. G ATP-linked respiration after exposure to CSE relative to controls in A549 cells. QPCR was used to determine mtDNA amount (H), mtDNA damage (I), and common deletions (CD, J) in A549 cells. Representative histograms using MitoSOX staining and flow cytometry analysis (K) and the quantification of fluorescence intensity (L) in A549 cells. M Representative Western blotting images of MLE15 cells treated with NT (non-target) or PICT1 siRNA. N Histograms of MitoSOX staining by flow cytometry analysis (N) and quantification (O) in MLE15 cells. Data are shown as means ± SEM (KD – knockdown, N = 3 – 10 experimental replicates). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Article Snippet: PICT1 knockout A549 cell line was generated using PICT-1 CRISPR plasmid (Santa Cruz Biotechnology) and CRISPR-Cas9 technology, as we previously described [18].

Techniques: Staining, Immunofluorescence, Flow Cytometry, Fluorescence, Western Blot, Knockdown

Journal: Cell communication and signaling : CCS

Article Title: Mitochondrial dysfunction and impaired DNA damage repair through PICT1 dysregulation in alveolar type II cells in emphysema.

doi: 10.1186/s12964-024-01896-0

Figure Lengend Snippet: Fig. 7 The role of PICT1 in nuclear DNA damage and mitochondrial (mt) function. Increased PICT1/TRIM22 interaction induced by smoking leads to decreased PICT1 levels and high ROS production. This caused nuclear and mtDNA damage, common deletions, mitochondrial superoxide generation, and reduced mtDNA amount and respiration, contributing to ATII cell death and emphysema development

Article Snippet: PICT1 knockout A549 cell line was generated using PICT-1 CRISPR plasmid (Santa Cruz Biotechnology) and CRISPR-Cas9 technology, as we previously described [18].

Techniques: